Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Expression of SNAI1 in tumor tissues and compared to normal control tissues. A . Tumor tissues and compared to normal control tissues. B . Different stages. C . Metastasis status

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques: Expressing, Control

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Optimal Threshold Analysis of SNAI1 expression. Optimal threshold analysis software(X-tile Software) was employed to stratify SNAI1 expression into three-tier ( A , B ) and two-tier ( C , D ) classifications for patient prognosis analysis. Impact of Metastasis status ( E ) and SNAI1 Expression ( F ) on LUSC Prognosis

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques: Expressing, Software

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Validation of SNAI1 expression and prognosis correlation in multiple LUSC datasets (Gene Expression Omnibus (GEO) database: GSE3141, GSE29013, GSE4573, GSE157011)

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques: Expressing

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Clinical characteristics

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques:

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Univariate and multivariate Cox regression analyses

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques:

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: The expression of SNAI1 protein in LUSC associated with prognosis

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques: Expressing

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: The hallmark gene sets correlated with SNAI1 expression

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques:

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: SNAI1 Expression Correlates with Immune Checkpoint Molecules in LUSC

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques: Expressing

Journal: Journal of Cardiothoracic Surgery

Article Title: SNAI1: a key modulator of survival in lung squamous cell carcinoma and its association with metastasis

doi: 10.1186/s13019-024-03044-8

Figure Lengend Snippet: Identification of potential molecular targeted drugs for SNAI1

Article Snippet: The subcellular localization of the SNAI1 protein within LUSC tissue cells was investigated using immunohistochemistry data sourced from the Human Protein Atlas database.

Techniques:

Journal: iScience

Article Title: Downregulation of protein kinase C gamma reduces epithelial property and enhances malignant phenotypes in colorectal cancer cells

doi: 10.1016/j.isci.2022.105501

Figure Lengend Snippet: PKCγ expression is associated with the epithelial properties of CRC cells (A) The expression of PKCγ and E-cadherin in CaCo-2, WiDr, DLD-1, SW480, SW620, Lovo, and HCT116 cells was quantified using western blotting. The correlation between PKCγ and E-cadherin expression was assessed using Pearson’s product-moment correlation test. (B) Western blot analyses of PKCγ and other marker proteins in DLD-1 and SW480 cells expressing SNAI1. (C) The relative expression levels of CDH1 (E-cadherin) and PRKCG (PKCγ) normalized to that of GAPDH , were determined by qPCR analyses in DLD-1 and SW480 cells expressing SNAI1 (n = 6, each). Data represent means ± SD. Statistical analysis was performed using Student’s t test. ∗∗p < 0.01; ∗∗∗p < 0.001. See also Figures S1 and , and Table S1 .

Article Snippet: human SNAI1 -Reverse; CGCCTGGCACTGGTACTTCTT , FASMAC , N/A.

Techniques: Expressing, Western Blot, Marker

Journal: iScience

Article Title: Downregulation of protein kinase C gamma reduces epithelial property and enhances malignant phenotypes in colorectal cancer cells

doi: 10.1016/j.isci.2022.105501

Figure Lengend Snippet:

Article Snippet: human SNAI1 -Reverse; CGCCTGGCACTGGTACTTCTT , FASMAC , N/A.

Techniques: Recombinant, Reporter Assay, Expressing, Negative Control, Plasmid Preparation, Software

Journal: iScience

Article Title: Interactome analysis reveals endocytosis and membrane recycling of EpCAM during differentiation of embryonic stem cells and carcinoma cells

doi: 10.1016/j.isci.2021.103179

Figure Lengend Snippet: Endocytosis of EpCAM during mesodermal differentiation of ESC (A) Left: EpCAM expression in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation (see ) was analyzed with Alexa-488-labeled specific antibody. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Middle and right: EpCAM endocytosis (middle) and membrane recycling (right) was assessed in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Student's t test; ∗∗ 0.01, ∗∗∗ 0.001, ∗∗∗∗ 0.0001. (B) EpCAM expression in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation was analyzed with Alexa-488-labeled specific antibody. Shown are representative examples of unstained pluripotent ESCs and stained pluripotent (D0) and mesodermally differentiated ESCs (D5) in gated dot plots from n = 3 independent experiments performed in duplicates. (C) Expression of pluripotency markers Sox2, Oct3/4 and Nanog, and mesodermal markers α-CAA and vimentin was quantified by qRT-PCR in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in triplicates. Student's t test is indicated. ∗∗ ≤0.01; ∗∗∗∗ ≤0.0001. (D) Left: EpCAM expression in Kyse30 carcinoma cells under control (Ctrl.) and following TGFβ treatment (TGFβ) (see ) was analyzed with Alexa-488-labeled specific antibody. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Middle and right: EpCAM endocytosis (middle) and membrane recycling (right) was assessed in Kyse30 cells under control (Ctrl.) and following TGFβ treatment (TGFβ). Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Student's t test; ∗∗ 0.01, ∗∗∗∗ 0.0001. (E) The mRNA expression of EMT transcription factors ZEB1/2, SNAI1/2, and TWIST was quantified by qRT-PCR in Kyse30 cells under control (Ctrl.) and following TGFβ treatment (TGFβ). Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in triplicates. Student's t test; ∗∗∗∗ 0.0001, n.s. not significant.

Article Snippet: Human SNAI1 , Metabion, Germany , Forward: AGATGAGCATTGGCAGCGAG Reverse: TGGGAAGCCTAACTACAGCGA.

Techniques: Expressing, Labeling, Membrane, Staining, Quantitative RT-PCR, Control

Journal: iScience

Article Title: Interactome analysis reveals endocytosis and membrane recycling of EpCAM during differentiation of embryonic stem cells and carcinoma cells

doi: 10.1016/j.isci.2021.103179

Figure Lengend Snippet:

Article Snippet: Human SNAI1 , Metabion, Germany , Forward: AGATGAGCATTGGCAGCGAG Reverse: TGGGAAGCCTAACTACAGCGA.

Techniques: Recombinant, SYBR Green Assay, Plasmid Preparation, Modification, Clone Assay, Amplification, Software