Journal: Journal of Biological Chemistry

Article Title: Lung Tumor-associated Osteoblast-derived Bone Morphogenetic Protein-2 Increased Epithelial-to-Mesenchymal Transition of Cancer by Runx2/Snail Signaling Pathway

doi: 10.1074/jbc.m111.256156

Figure Lengend Snippet: FIGURE 7. Runx2 is the upstream regulatory factor of Snail. A and B, inhibition of Runx2 decreases BMP-2-mediated Snail up-regulation and E-cadherin down-regulation (A), as well as cell migration (B). Cells were transfected with pLKO-AS2 or pLKO-AS2-RUNX2 shRNA. Stable clones were created by puromycin selection, and the efficacy of shRNA was assessed by RT-PCR. Cells were treated with BMP-2 (20 ng/ml) for the specified times (cell migration, 24 h; Runx2 and Snail, 6 h; E-cadherin, 24 h). Then the expression of various proteins was then assessed by immunoblot assay. C, overexpression of Snail reversed the inhibitory effect of Runx2 shRNA on BMP-2-mediated cell migration. Runx2-transfected A549 and CL1–0 cells were transected with pCMV or pSnail plasmid, and stable clones were established by G418 and puromycin. The asterisk indicates a significant difference between control and test groups, as analyzed by Dunnett’s test (p 0.05). The data shown are representative of three independent experiments.

Article Snippet: Runx2-transfectedA549 andCL1–0 cell were transected with pCMV or pSnail plasmid (Origene, FIGURE 1.

Techniques: Inhibition, Migration, Transfection, shRNA, Clone Assay, Selection, Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Over Expression, Plasmid Preparation, Control

Journal: The Journal of steroid biochemistry and molecular biology

Article Title: Epithelial-to-mesenchymal transition contributes to the downregulation of progesterone receptor expression in endometriosis lesions.

doi: 10.1016/j.jsbmb.2021.105943

Figure Lengend Snippet: Fig. 3. TGF-β1 dose-dependent changes of gene expression in endometriotic epithelial cell lines (A) EM’osis cells and (B) 12Z cells were treated in triplicates with TGF-β1 (0.125, 0.25, 0.5, 0.75, 1 ng/mL) for 24 h. Values are presented by mean ± SEM of one representative experiment. (C) Expression of CDH2, PGR, and EMT related TFs (ZEB1, SNAI1 and SNAI2) in EM’osis cells treated in four independent experiments with TGF-β1 (1 ng/mL) and TGF-β1 inhibitor (100 nM) for 24 h. Control group were under the equivalent volume of vehicles. (D) Expression of CDH2, PGR, and EMT related TFs (ZEB1, SNAI1 and SNAI2) in 12Z cells treated in four independent experiments with TGF-β1 (0.5 ng/mL) and TGF-β1 inhibitor (100 nM) for 24 h. Values are presented as mean ± SEM and P values were calculated by one-way ANOVA test. * P < 0.05, **P < 0.001, “ns” stands for non-significant.

Article Snippet: 12Z cells were transfected with 20 nM of a pool of equal proportion of 3 siRNA against SNAI1 (SR304489, Human siRNA Oligo Duplex, Locus ID 6615, Origene, USA), as well as SNAI2 (Silencer siRNA ID 106954, Ambion Inc., USA) or scrambled control from the same set of si-SNAI1 (SR304489, Human siRNA Oligo Duplex, Locus ID 6615, Origene USA).

Techniques: Gene Expression, Expressing, Control

Journal: The Journal of steroid biochemistry and molecular biology

Article Title: Epithelial-to-mesenchymal transition contributes to the downregulation of progesterone receptor expression in endometriosis lesions.

doi: 10.1016/j.jsbmb.2021.105943

Figure Lengend Snippet: Fig. 4. EMT related PR repression is SNAI- dependent (A) Silencing SNAI1 in EM’osis cells was done by transfection of siRNA against SNAI1 (20 nM) in triplicates in two indepen dent experiments. Transfections with the same amount of scrambled siRNA, and untreated cells were used as controls. (B) Silencing SNAI1/2 in 12Z cells was performed in triplicates in two independent experiments, using the pooled SNAI1/2 with 2:1 ratio of si-SNAI1 and si- SNAI2. Controls were the same as for EM’osis cells. (A, B) Values are presented as mean ± SEM and P values were calculated by one-way ANOVA test. * P < 0.05, **P < 0.001, “ns” stands for non-significant. (C–F) Representative staining of SNAI1/2 (green) was shown in part of epithelial component, and the representative staining of PR (red) in ectopic epithelial glands (magnification 400x). The grey scale bars represent 50 μm. (G) Correlation analysis on the intensity of fluorescence for SNAI1/2 and PR in epithelial cells. DIE lesions were co-stained with PR and SNAI1/2, and the intensities of fluorescence were quantified by Qupath in each epithelial cells. P value was calculated by Pearson r.

Article Snippet: 12Z cells were transfected with 20 nM of a pool of equal proportion of 3 siRNA against SNAI1 (SR304489, Human siRNA Oligo Duplex, Locus ID 6615, Origene, USA), as well as SNAI2 (Silencer siRNA ID 106954, Ambion Inc., USA) or scrambled control from the same set of si-SNAI1 (SR304489, Human siRNA Oligo Duplex, Locus ID 6615, Origene USA).

Techniques: Transfection, Staining, Fluorescence

Journal: Oncogene

Article Title: Aurora-A kinase oncogenic signaling mediates TGF-β-induced triple-negative breast cancer plasticity and chemoresistance.

doi: 10.1038/s41388-021-01711-x

Figure Lengend Snippet: Fig. 4 Transcriptomic analysis of MDA-MB 231 TNBC cells. a RNA-Seq analysis was performed on MDA-MB 231 cells treated with 10 ng/ml TGF-β1 for 48 h. 14,239 genes were differentially expressed between control and TGF-β1 groups. b STRINGdb software was used to identify a SNAI1/ MMP9/FN1 Network. c Quantification analysis showing FN1, MMP9, and SNAI1 expression before and after TGF-β1 treatment. Experiments were performed in triplicate with a p-value < 0.05. d Real-time quantitative RT- PCR to detect SNA1, FN1, and MMP9 gene expression using MDA-MB 231 cells treated with 10 ng/ml TGF-β1 and infected with scrambled Lenti-shRNA or Lenti-shRNA targeting AURKA (Origene) for 48 h. Three independent experiments were performed in triplicate (±S.D. and P-value < 0.05).

Article Snippet: Scrambled (control), AURKA (Origene, TL320538), SMAD3 (Origene, TL309254), and SNAI1 shRNA lentivectors (Origene, TL309226) were purchased by OriGene Technologies (Rockville, MD, USA) and used according to manufacturer’s instructions.

Techniques: RNA Sequencing, Control, Software, Expressing, Quantitative RT-PCR, Gene Expression, Infection, shRNA

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells

doi: 10.1186/s13046-016-0415-y

Figure Lengend Snippet: MiR-137 and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail cDNA vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01

Article Snippet: MiRNA mimic and miRNA inhibitor for miR-137 or miR-34a (30 nM, Ambion), Snail siRNA (5 nM, Ambion) and Snail cDNA plasmids (OriGene) were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.

Techniques: Transfection, Plasmid Preparation, Invasion Assay, Tube Formation Assay, Western Blot

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells

doi: 10.1186/s13046-016-0415-y

Figure Lengend Snippet: MiR-137 and miR-34a are downregulated in OC tissues and decreased expressions of miR-137 and miR-34a are associated with poor survival in OC patients. a Venn diagram showing the overlap of miRNAs that were predicted to bind to the Snail 3′-UTR by alternative algorithms (TargetScan, miRSystem and DIANA-MicroT-CDS). The 6 predicted miRNAs were common to these three algorithms. b , c qPCR analysis of miR-137 ( b ) and miR-34a ( c ) levels in 50 paired cancerous and normal tissue samples from OC patients. d , e Kaplan-Meier analysis of overall survival in 50 OC patients with high median ( n = 25) or low median ( n = 25) expression levels of miR-137 ( d ) or miR-34a ( e )

Article Snippet: The Snail 3′-UTR luciferase vector was purchased from OriGene.

Techniques: Expressing

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells

doi: 10.1186/s13046-016-0415-y

Figure Lengend Snippet: Snail is a direct target of miR-137 and miR-34a in OC cells. a Relative miR-34a expression in OC cell lines (SKOV-3 and ES-2) and normal ovarian epithelial NOEC cells. b , c ES-2 cells were transfected with reporter constructs containing either wild-type (WT) Snail , or Snail 3′-UTR with mutation (MUT), along with miR-137 mimic ( b ), miR-34a mimic ( c ), or negative control mimic (Neg mimic), respectively. Relative luciferase activity was measured. d , e qPCR analysis of Snail expression in OC cells after overexpression ( d ) or knockdown ( e ) of miR-137 and miR-34a. f Western blotting analysis of Snail expression in OC cells after overexpression or knockdown of miR-137 and miR-34a. g , h qPCR analysis of indicated mRNAs in OC cells after transient overexpression or knockdown of miR-137 ( g ) and miR-34a ( h ). i Relative mRNA expression of Snail in OC tissues and matched normal tissues. j Analysis of Snail mRNA expression using microarray (Oncomine) on normal ovary versus OC tissue. ** P < 0.01

Article Snippet: The Snail 3′-UTR luciferase vector was purchased from OriGene.

Techniques: Expressing, Transfection, Construct, Mutagenesis, Negative Control, Luciferase, Activity Assay, Over Expression, Western Blot, Microarray

Journal: Cancer Research Communications

Article Title: MARCH2, a Novel Oncogene-regulated SNAIL E3 Ligase, Suppresses Triple-negative Breast Cancer Metastases

doi: 10.1158/2767-9764.CRC-23-0090

Figure Lengend Snippet: MARCH2 promotes ubiquitination and downregulation of SNAIL. A, HA-tagged WT, but not RING domain–mutant (W97A), MARCH2 downregulates SNAIL levels in MDA-MB-231 cells. B, MARCH2 coprecipitates with SNAIL in MDA-MB-231 cells coexpressing FLAG-SNAIL and HA-MARCH2. C, WT, but not RING domain– or transmembrane domain–mutant, MARCH2 ubiquitinates SNAIL. FLAG-Snail was immunoprecipitated from MDA-MB-231 cells coexpressing FLAG-Snail, HA-Ubiquitin and GST-tagged MARCH2 constructs. Immunoprecipitates were blotted with antibodies to HA to assess ubiquitination. D, MARCH2 ubiquitinates SNAIL in in vitro ubiquitination assay. Reactions were performed with recombinant SNAIL (Myc-tagged) in the presence of ubiquitin, recombinant E1 (UBE1), recombinant E2 (UBE2D3) and/or recombinant MARCH2.

Article Snippet: The in vitro ubiquitination reactions were performed using 2 µmol/L recombinant human SNAIL protein (Origene TP304581), 3 µmol/L recombinant human March2 E3 ligase (Origene TP307517), 100 µmol/L Ubiquitin (R&D Systems U-100H-10M), 100 nmol/L recombinant E1(UBE1, Biotechne E-305), 500 nmol/L recombinant E2 (UBE2D3, Biotechne E2-627), 1X ATP Energy Regeneration buffer (Enzo BML-EW9810-0100) in a 25 µL reaction buffer containing 50 mmol/L Hepes, pH 8.0, 50 mmol/L NaCl, and 1 mmol/L TCEP.

Techniques: Mutagenesis, Immunoprecipitation, Construct, In Vitro, Ubiquitin Assay, Recombinant

Journal: iScience

Article Title: Interactome analysis reveals endocytosis and membrane recycling of EpCAM during differentiation of embryonic stem cells and carcinoma cells

doi: 10.1016/j.isci.2021.103179

Figure Lengend Snippet: Endocytosis of EpCAM during mesodermal differentiation of ESC (A) Left: EpCAM expression in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation (see ) was analyzed with Alexa-488-labeled specific antibody. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Middle and right: EpCAM endocytosis (middle) and membrane recycling (right) was assessed in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Student's t test; ∗∗ 0.01, ∗∗∗ 0.001, ∗∗∗∗ 0.0001. (B) EpCAM expression in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation was analyzed with Alexa-488-labeled specific antibody. Shown are representative examples of unstained pluripotent ESCs and stained pluripotent (D0) and mesodermally differentiated ESCs (D5) in gated dot plots from n = 3 independent experiments performed in duplicates. (C) Expression of pluripotency markers Sox2, Oct3/4 and Nanog, and mesodermal markers α-CAA and vimentin was quantified by qRT-PCR in E14TG2α ESC under pluripotency (day 0, D0) and following mesodermal differentiation. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in triplicates. Student's t test is indicated. ∗∗ ≤0.01; ∗∗∗∗ ≤0.0001. (D) Left: EpCAM expression in Kyse30 carcinoma cells under control (Ctrl.) and following TGFβ treatment (TGFβ) (see ) was analyzed with Alexa-488-labeled specific antibody. Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Middle and right: EpCAM endocytosis (middle) and membrane recycling (right) was assessed in Kyse30 cells under control (Ctrl.) and following TGFβ treatment (TGFβ). Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in duplicates. Student's t test; ∗∗ 0.01, ∗∗∗∗ 0.0001. (E) The mRNA expression of EMT transcription factors ZEB1/2, SNAI1/2, and TWIST was quantified by qRT-PCR in Kyse30 cells under control (Ctrl.) and following TGFβ treatment (TGFβ). Shown are scatter dot plots with means and SD of n = 3 independent experiments performed in triplicates. Student's t test; ∗∗∗∗ 0.0001, n.s. not significant.

Article Snippet: Human SNAI1 , Metabion, Germany , Forward: AGATGAGCATTGGCAGCGAG Reverse: TGGGAAGCCTAACTACAGCGA.

Techniques: Expressing, Labeling, Membrane, Staining, Quantitative RT-PCR, Control

Journal: iScience

Article Title: Interactome analysis reveals endocytosis and membrane recycling of EpCAM during differentiation of embryonic stem cells and carcinoma cells

doi: 10.1016/j.isci.2021.103179

Figure Lengend Snippet:

Article Snippet: Human SNAI1 , Metabion, Germany , Forward: AGATGAGCATTGGCAGCGAG Reverse: TGGGAAGCCTAACTACAGCGA.

Techniques: Recombinant, SYBR Green Assay, Plasmid Preparation, Modification, Clone Assay, Amplification, Software